![]() ![]() ![]() ![]() |
Ask a Geneticist![]() by Dr. Barry Starr, Stanford University Hello, is it possible for the results of a DNA paternity test to be wrong and in what circumstances might this happen?
The next two possibilities are real but rare. One of these is DNA mutation. DNA mutations are changes in our DNA. These happen all the time. They can happen when a sperm is being made. Or when a cell divides. Or when sunlight hits a cell. There are lots of ways our DNA can be changed. Pretty obviously DNA changes can affect the results of a DNA paternity test. Imagine that a man fathers a child with a sperm that has a DNA mutation. This DNA mutation will make the child different from the father at one particular DNA spot. Now to affect the paternity test, the change would have to happen in the part of the DNA that is tested. In other words, with 6 billion letters to choose from, the mutation has to happen in the right place. This is pretty uncommon. And just being different at one spot isn't enough. DNA paternity tests look at many DNA sites. For red flags to go up, there have to be at least two spots that are different. You need for two changes to happen in two specific different places at the same time. This is even less likely. But it does happen. The sites used by DNA testing companies have relatively high mutation rates. The numbers I've seen say the average is 1 in 500. So the chances for mutations to happen in two spots are around 1 in 250,000. Of the over 4 million babies born in the U.S. each year, 16 of them would be predicted to have mutations at two sites. And most likely the number is actually higher than this. Why? First off, not all sites get DNA changes at the same rate. Some get DNA changes less often. And some get them more often. The highest rate I've seen is around 1 in 100. A couple of sites like this can bring the number of babies born with double mutations up to 400/year. ![]() Older men's sperm have more DNA mutations. So as dads get older, the chances go even higher that there will be a double mutation. There isn't an exact number for how much a father's age affects the chances for a mutation. But we do know that it goes up. And it is important to mention that the mutation rates at the sites tested haven't been looked at exhaustively, at least not in the scientific literature. The mutation rates are based on a few studies and so may be off. Now DNA testing companies are aware of all of this. A good company will order additional testing if there are two differences. At least if the differences are small. Big differences aren't usually the result of DNA mutation at these sites. The DNA used is called short tandem repeats or STRs. Here is an example of an STR found on the Y chromosome: TCTGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA What a mess! To make it simpler, scientists write it out like this: (TCTG)3(TCTA)10 This just means that there are three repeats of TCTG and 10 repeats of TCTA. This sort of thing not only confuses us, but it confuses our cells too. When our cells start copying this DNA (as they do when a cell divides), the cell's machinery can sometimes lose its place. Often a cell will put an extra copy in or take one out. Very rarely they'll put in or take out two repeats. More than two is rarer still. So if there are two changes by a single repeat (called double exclusion), a company should definitely do further testing. But what if one of the changes is a double repeat? Or there are three changes? Whether to get additional testing would depend on the situation. For example, if the potential dad is 75 and the changes are in sites with a high mutation rate, additional testing might be warranted.
The final off-the-top-of-my-head example is probably the most rare—chimerism (click here to learn more). A chimera is really like two siblings rolled up into one person. Imagine that a mom is going to have fraternal twins. Fraternal twins happen when two different eggs are fertilized by two different sperm. These twins are no more similar than any siblings. Now imagine that at a very early stage, these twins fuse together to make a single person. This single, fused person is a chimera. Let's say at the fusion stage, there are 8 cells from each sibling. These 16 cells divide and divide until there are the trillions of cells that make up a baby. Half of these trillions of cells will come from one sibling and half from the other. Let's say that one sibling's cells were responsible for all of the chimera's sperm. And the other sibling's cells were responsible for cheek and blood cells. Now the chimera fathers a child. To test if he is the father, the testing company looks at the DNA of his cheek cells. Or his blood. Because the DNA in the tested cells is different from the DNA in the sperm, there is a chance that the test may not identify the man as the father. Why only a chance? Because the different DNAs came from two people who would have been siblings if they hadn't fused together. And as we talked about, brothers can sometimes not be told apart with standard DNA testing. So the chimera might come out looking like the dad. Or he might not. Further testing in this case would rule him out as the dad! No one knows how common chimerism is but it is thought to be pretty rare. So this scenario might not happen too often. But it is a formal possibility. Sorry for the long answer. As you can see, there are a number of ways a DNA paternity test can be wrong. With the exception of human error, most cases would probably be pretty rare.More work definitely needs to be done in this field to figure out how rare. How common are chimeras? What are the mutation rates at the various DNA sites the companies test for? Do some sites more commonly gain or lose two or more repeats? What are the specific numbers for how much age affects a man's mutation rate at these particular sites? Until these questions are answered, we won't know how common these sorts of false positives and negatives are. Hopefully scientists are working on this as we speak. More Information |
|
|||