![]() ![]() ![]() ![]() |
Tiny RNAs make a big differenceMicro-RNAs are critical for immune and heart function![]() by Dr. Barry Starr, Stanford UniversityScientists have found new bits of RNA that are critical for our immune systems to develop and work properly. And for our hearts to develop and respond to stress. This would be big news if these were run of the mill genes. But the news is even bigger because they're not normal genes. These RNAs are doing work for themselves. Which in not typical for RNA. These little RNAs (and others like them) have added a new layer of complexity to our understanding of how our cells work. See, a while back biology seemed simple enough. There was good old DNA that had some instructions in it. The instructions were copied into RNA. And the cells read the RNA and made proteins that did all the work in the cell. This idea even has a name—the central dogma. Unfortunately, it is woefully incomplete. First scientists found RNA viruses. These RNA viruses use special proteins called reverse transcriptases that turn their RNA into DNA. So that went against the dogma. And later they found RNAs that do the work of enzymes. Enzymes are proteins that help chemical reactions go faster in the cells. Another exception. Then scientists found more RNAs doing the work of proteins. These are small RNAs that are now called micro-RNAs. Because they are very, very small. What these little RNAs do is help figure out how much of a protein should get made. This is also usually the work of other proteins. So there are lots of exceptions to the central dogma. But by and large, they have been pretty minor exceptions. Mostly the central dogma has held up pretty well. Until now. It is these last RNAs that are really giving the dogma a run for its money. Scientists have identified over 500 of these micro-RNAs so far in mammals. And some scientists think there might be over 1000 or even 10,000 of them in our DNA. Because of these kinds of numbers, scientists suspected micro-RNAs were probably pretty important in mammals. And now they have just confirmed it. Two groups showed that one of these micro-RNAs is critical for a working immune system in mice. Another group showed that two different micro-RNAs are important for a mouse's heart to work properly. So much for the central dogma. Knocking out RNA![]() Removing DNA from mice can tell us a lot about what that DNA does. Scientists weren't sure if these kinds of experiments would work with micro-RNAs. Why not? Because genes are usually affected by lots of different micro-RNAs. So getting rid of one might not have much of an effect. This was not the case with a micro-RNA called miR-155 (micro-RNA 155). Scientists suspected that this little guy was important for the immune system. Some cancers made extra miR-155. And when certain cells of the immune system got excited, they made more of it. I am not sure scientists expected to see such a big effect when they got rid of it though. When they removed this micro-RNA from a mouse, the mouse's immune system no longer worked well at all. They had fewer B cells in the gut which made it harder to fight off infections. In fact, when scientists tried to immunize the mouse against the bacteria Salmonella, it didn't work. Normal mice could fight off the Salmonella when they were immunized. Our knockout mouse died. As did all of his littermates with the same missing RNA. The mouse also looked a bit like he had asthma. At least his lungs did. All of this shows miR-155 is important for the immune system of mice. And this isn't the only important micro-RNA. Two different micro-RNAs were important for the heart. When scientists knocked one of them out, half the mice died young from holes in the heart. And the other half died later from heart rhythm problems. A second micro-RNA also affected the heart. But this effect only became apparent when the mouse's heart was stressed. Like with hardening of the arteries. In other words, these mice could not handle hardening of the arteries as well. So whether we like it or not, these micro-RNAs are here to stay. Who knows what the other 500 or so will do? Or the other 10,000… And maybe some of these micro-RNAs are important in disease. They would then provide new targets for scientists to go after to make new medicines. More InformationHow micro-RNAs work![]() Micro-RNAs keep a cell from reading mRNAs. As I said before, the central dogma says that the cell's machinery copies the DNA of a gene into RNA. And that the RNA is translated into a protein. The protein then goes on to perform a job. Micro-RNAs work at the middle step of this process—on the RNA. What they do is stick to certain RNAs and either send them off to be destroyed or keep the cells from reading them. Both processes result in the same thing—no protein. And both rely on turning single stranded RNA into partly double stranded RNA. Imagine you have an RNA that is 1000 nucleotides long. This means it has 1000 A's, C's, G's, and T's all arranged in a certain order. At one end of this piece of RNA is the following certain sequence of letters: AUGCAUGCAUGCAUGCAUGCAU Let's say the cell makes a micro-RNA (from the DNA) with the following sequence: UACGUACGUACGUACGUACGUA Remember, the base pair rules are that A likes U and C likes G. So these two are a perfect match and so end up sticking together like this: AUGCAUGCAUGCAUGCAUGCAU UACGUACGUACGUACGUACGUA This double stranded RNA sets off some alarms in the cell. Unlike DNA, RNA is usually made up of a single strand. While there are some acceptable forms of double stranded RNA (like tRNA, rRNA, etc.), most are intolerable to the cell. When there is a perfect match like this, the RNA is cut and sent off for destruction. These micro-RNAs are called siRNA—silencing RNAs. And the process is called RNA interference (RNAi). Most micro-RNAs don't work this way though. They have an incomplete match with their mRNA. For example, perhaps the micro-RNA looks like this: UACCUACCUACCUACCUACGUA Now what appears to happen is that the RNA is not degraded. Instead, some proteins bind to this double stranded RNA and keep the RNA from being read in the cell. The results of both of these are that an RNA does not get read by the cell. If the RNA is not read, no protein gets made. It is like the gene isn't there. In essence, the micro-RNA, found somewhere else in the DNA, is causing the gene not to work. Sort of like a faraway mutation. I wonder how many unexplained phenomena will be explained with micro-RNAs. I can't wait to find out. More InformationContent provided by the Department of Genetics, Stanford University. |
|
|||