Understanding GeneticsUnderstanding GeneticsUnderstanding GeneticsUnderstanding Genetics
HomeFeature StoryGenetics in the NewsEthics & IssuesAsk a GeneticistAt Home ActivitiesAbout the Museum Exhibition


How Stem Cells Turn into Skin Cells

A Small RNA, miR-203, is Critical for Skin Creation

portrait_barry.jpg
by Dr. Barry Starr, Stanford University

March 07, 2008

A recent study has shown that a small RNA called miR-203 is important for turning a stem cell into a skin cell. The way this RNA probably works is by causing the p63 gene to be shut off.

This makes sense since p63 is involved in letting a cell continue to make new copies of itself. Which is a key feature of stem cells. And of cancer cells.

I mention this because some cancer cells also make a lot of p63. Perhaps the RNA the researchers discovered here can be used to treat some of these cancers. By shutting down p63 in these cells, miR-203 should stop them from dividing.

Finding out about miR-203 also let the investigators study whether all animals make skin the same way. Looking at the DNA of humans, chickens, and zebrafish, the researchers concluded that they share the same system for making skin. This suggests that skin making evolved once over 400 million years ago.

How Skin Works


Skin cells are being
replaced constantly.
Skin is a very important organ. It keeps the good things in and the bed things out. So, for example, water stays in and bacteria are kept out.

Skin is also an important defense for our DNA. DNA in skin takes a beating from the environment. Sunlight, pollutants and many other things all damage a skin's DNA.

Skin protects our DNA by killing itself off. We slough off around 30,000 skin cells per minute. All of these cells are replaced with new skin cells with healthy DNA. (Except when someone gets skin cancer.)

For all of this to work, there has to be a secure source of new skin cells. This is where skin stem cells come in.

Skin stem cells sit underneath the skin where they are protected from the environment. There they have two important functions. They send cells to the surface to become skin cells. And they make new copies of themselves so there will always be new stem cells to turn into skin cells.

Turning a Stem Cell into a Skin Cell

Turning a stem cell into a skin cell is not a simple process. Some stem cells need to stay stem cells. Other cells need to go on to become skin cells.

A stem cell is very different from a skin cell. A stem cell needs to make new copies of itself all the time. It also needs to keep the ability to turn into other kinds of cells.

A skin cell doesn't need to do either of these things. It mostly needs to be tough enough to keep good things in and the bad things out.

One obvious sort of gene that might be involved in turning a stem cell into a skin cell is one that keeps stem cells from dividing. This is what the researchers found in miR-203.

The researchers started out by looking at mouse embryos. Mouse embryos take about 20 days to completely develop. At day 13 their "skin" is still mostly made of stem cells. By day 15 they have lots of real skin.

So the researchers looked for genes that were different between day 13 and day 15 skin. What they found was that there was hardly any miR-203 at day 13 but lots of it at day 15.

mouseDNA.jpg
Mice were used to figure out
that miR-203 is important
in skin creation.
When the researchers looked more closely, they found that there was a lot of miR-203 in the outer layer of skin and hardly any in the lower levels where the stem cells are. Of course this could just be a coincidence. To confirm that miR-203 is actually involved in making a skin cell, the researchers did two things:

  1. They created mice that made more miR-203 in stem cells

  2. They created mice that made less miR-203 in skin

If miR-203 is involved in making skin, then you can make a few predictions about what might happen in these mice. If miR-203 is made in stem cells, then the mice might run out of stem cells and have thin skin. This is what the researchers found.

If miR-203 is made in the skin, then you might predict that the skin cells would start to make copies of themselves. Again, this is what the researchers found.

These two experiments confirmed that miR-203 is involved in making skin. And that it might be partly doing it by shutting down a stem cell's ability to make new copies of itself. But how does it work?

More Information

miR-203 Works Through Inhibiting p63

To understand how this little RNA could be having such a big effect, we need to dig a bit deeper into what microRNAs do. The main job of a microRNA is to make a gene less active. Or to stop it completely.

Genes have to be on to have an effect. And they can be on at different levels. When genes are on at different levels, they can have different effects.

For example, the lactase gene is involved in digesting lactose, the sugar in milk. As some people get older, the gene starts shutting off. These people become more and more lactose intolerant as they age.

Eventually, many of these people will become completely lactose intolerant. At this point, their lactase gene will be turned off. The gene is there but it has no effect because it isn't on.

MicroRNAs turn specific genes down or completely off. So the researchers looked to see which genes miR-203 turns down.

What they found was that when miR-203 was turned up, a gene called p63 was turned down. When miR-203 is around, there is very little p63 around. And when it is absent, there is lots of p63.

This makes sense as p63 is involved in helping cells divide and make more copies of themselves. However, because of the way microRNAs work, scientists could tell that miR-203 didn't directly affect p63. It had to be affecting p63 in some other way.

How Micro-RNAs Work

featurearticlefigures.gif
Micro-RNAs work by stopping translation.
To understand why the researchers knew that miR-203 didn't directly affect p63, we need to understand how genes work. When a gene is read, it is copied into RNA. That RNA is then translated into a protein. The protein then goes on to perform some specific job.

So for p63, the cell reads the p63 gene and turns it into an RNA. The RNA is then translated into the p63 protein. It is the p63 protein that keeps a skin stem cell from turning into a skin cell.

MicroRNAs target the RNA that gets translated. They either have it destroyed or interfere with its translation. Either way the end result is no protein.

Of course a cell would want this sort of thing to be specific. Otherwise these little RNAs would wreak havoc throughout the cell by shutting down many different genes.

The way a microRNA gets its specificity has to do with how RNA and DNA work. DNA is made up of four different bases—A, G, C, and T. RNA is similar except that the T is a U.

In DNA, an A is always matched with a T and a C with a G. The only difference with RNA is that an A is always matched with a U.

For microRNAs to be effective, they need to match up exactly with another RNA. It is this double stranded RNA that alerts a cell not to translate a particular RNA or to destroy it.

The sequence of the mouse miR-203 is:

GUGAAAUGUUUAGGACCACUAG

This means that it will recognize any RNA that has the following sequence:

CUAGUGGUCCUAAACAUUUCAC

The RNA that codes for p63 does not have this sequence or anything very similar. So it is very unlikely that miR-203 targets p63 directly. When the researchers searched the mouse genome, they found a gene with the unfortunate name Zpf281 that had four copies of that sequence in its RNA.

Most likely miR-203 works through this gene. The researchers showed that this gene was also highly expressed in stem cells.

They were also able to show that miR-203 could turn down the expression of this gene. And that when they changed the Zpf281 RNA so that the letters no longer matched up, miR-203 no longer decreased its expression.

What is probably going on is something like this. When a stem cell starts to become a skin cell, it makes more miR-203. This RNA then goes and shuts off Zpf281.

Zpf281 is probably needed to keep p63 on. When Zpf281 is gotten rid of, p63 slows down and stops working. Getting rid of p63 starts a whole set of steps that eventually turns a stem cell into a skin cell.

Future Work

Of course this is just the beginning—there is still a lot to find out. For example, what turns miR-203 on in the first place? And what happens if you add miR-203 to certain cancers?

Remember, some cancers are that way because they make too much p63. Adding miR-203 might stop them from being cancerous. We'll have to wait and see.

More Information





Content provided by the Department of Genetics, Stanford University.

footer graphic Home | Feature Story | Genetics in the News | Ethics & Issues
Ask a Geneticist | At Home Activities | About the Museum Exhibition
footer graphic
This project was supported by the Department of Genetics, Stanford School of Medicine. Its content is solely the responsibility of the authors and does not necessarily represent the official views of Stanford University or the Department of Genetics.

The Tech Museum of Innovation 201 South Market Street San Jose, CA 95113
(408) 294-TECH   info@thetech.org
© 1994-2004 The Tech Museum of Innovation - All rights reserved.